View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_45 (Length: 241)
Name: NF16630_low_45
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 52711128 - 52711342
Alignment:
| Q |
21 |
atgtcacaatcaaattattaataccctaaatgcttgtggagcttccatttgttaaccaagtttgtgccggccagcctacattatttgttacagccataaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711128 |
atgtcacaatcaaattattaataccctaaatgcttgtggagcttccatttgttaaccaagtttgtgccggccagcctacattatttgttacagccataaa |
52711227 |
T |
|
| Q |
121 |
tcaattgtaacccaaataaaaat----gatgaccttgcctgattgagacgctttcttccactctgctaacctatataaaatgcaaaattagtgttacttt |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52711228 |
tcaattgtaacccaaataaaaatgatggatgaccttgcctgattgagacgctttcttacactctgctaacctatataaaatgcaaaattagtgttacttt |
52711327 |
T |
|
| Q |
217 |
tcatttcatctcact |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52711328 |
tcatttcatctcact |
52711342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 37 - 231
Target Start/End: Original strand, 52720012 - 52720203
Alignment:
| Q |
37 |
attaataccctaaatgcttgtggagcttccatttgttaaccaagtttgtgccggccagcctacattatttgttacagccataaatcaattgtaacccaaa |
136 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52720012 |
attaataccctaaatgcctgtgaagcctccatttgttaaccaagtttgtgccagccagcctacattatttgttacagccataaatcaactgtaacccaaa |
52720111 |
T |
|
| Q |
137 |
taaaaatgatgaccttgcctgattgagacgctttcttccactctgctaacctatataaaatgcaaaattagtgttacttttcatttcatctcact |
231 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52720112 |
taaaa---atgaccctgcctgatcgagacgctttcttccactctgctaacatatataaaatgtaaaattagtgttacttttcatttcatctcact |
52720203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University