View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_49 (Length: 231)
Name: NF16630_low_49
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 40 - 98
Target Start/End: Original strand, 18514184 - 18514243
Alignment:
| Q |
40 |
tatcaattaggttggtttggcccaaagggttatgctttcataatgtt-gcgaactaaagt |
98 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
18514184 |
tatcaattaggttggtttggccgaaagggttatactttcataatgttagcgaactaaagt |
18514243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 18514277 - 18514314
Alignment:
| Q |
191 |
aaattgactattcttctttagtgagatttcttttttaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18514277 |
aaattgactattcttctttagtgagatttcttttttaa |
18514314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University