View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16630_low_50 (Length: 230)

Name: NF16630_low_50
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16630_low_50
NF16630_low_50
[»] chr2 (1 HSPs)
chr2 (8-215)||(11295580-11295806)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 11295806 - 11295580
Alignment:
8 agtgagatgaattaatgatttcttgaggaaatactggtatatgtgtagactatttgatttgannnnnnngtctcttagaataagtctaaaataaatatta 107  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
11295806 agtgaaatgaattaatgatttcttgaggaaatactggtatatgtgtagactatttgatttgatttttttgtctcttagaataagtctaaaataaatatta 11295707  T
108 t------------------gaacaaattttgcaaggacttctaaaacaaaacatcaaggaccaaaaacaaagttatatatgttcaaggactattaac-aa 188  Q
    |                  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||    
11295706 tagagacgaatttcaatatgaacaaattttgcaaggacttctaaaacaaaacatcaaggaccaaaaacaaagttatatatgttcaaggactaaaaacaaa 11295607  T
189 aaattttagaattcaaatatttttatg 215  Q
    |||||||||||||||||||||||||||    
11295606 aaattttagaattcaaatatttttatg 11295580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University