View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_52 (Length: 226)
Name: NF16630_low_52
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 52 - 208
Target Start/End: Original strand, 36476905 - 36477061
Alignment:
| Q |
52 |
aacaaattaacagaaaccttgatcttccgagagttacccatttcatgtcccttctttttgatccatgcatagccatgatcatttatataaatacatagat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476905 |
aacaaattaacagaaaccttgatcttccgagagttacccatttcatgtcccttctttttgatccatgcatagccatgatcatttatataaatacatagat |
36477004 |
T |
|
| Q |
152 |
atacggctagcactagatcgctagataaggagtagttttctaaatccgaataaatat |
208 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36477005 |
atacggctagctctagatcactagataaagagtagttttctaaatccgaataaatat |
36477061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 133
Target Start/End: Original strand, 36467266 - 36467344
Alignment:
| Q |
55 |
aaattaacagaaaccttgatcttccgagagttacccatttcatgtcccttctttttgatccatgcatagccatgatcat |
133 |
Q |
| |
|
|||||| ||||| ||||||||||||| || |||||||||||| || ||| |||| ||||||| ||| | |||| ||||| |
|
|
| T |
36467266 |
aaattatcagaacccttgatcttccgggaattacccatttcacgttcctcctttctgatccacgcacaaccatcatcat |
36467344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University