View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_56 (Length: 210)
Name: NF16630_low_56
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 8122562 - 8122386
Alignment:
| Q |
18 |
aaatcaactatctttccttttcaatggtggaatcttacatatcaatgtgaattcaatattannnnnnnaagtgtactctttaagtgtactctctcacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
8122562 |
aaatcaactatctttccttttcaatggtggaatcttacatgtcaatgtgaattcaatattatttttttaagagtactcttttagtgtactctctcacaaa |
8122463 |
T |
|
| Q |
118 |
taattgaaatataagcatagtaaata-tcataaattgtcatccaaaggaaccattcttattctttcaagccattctt |
193 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
8122462 |
taattgaaatataagcatagtaaatatttataaattgtcatctaaaccaaccattcttattctttcaagccattctt |
8122386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 12880084 - 12880120
Alignment:
| Q |
108 |
ctctcacaaataattgaaatataagcatagtaaatat |
144 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
12880084 |
ctctcacaagtaattgaaatataagcatagtagatat |
12880120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University