View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16630_low_58 (Length: 205)
Name: NF16630_low_58
Description: NF16630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16630_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 21 - 173
Target Start/End: Original strand, 30299976 - 30300123
Alignment:
| Q |
21 |
gagtggaattgatactttattctcagtgttgcactctgactcgatcttttttccttccgcaaaaacacttcacccgtttattaaagttaaaaagccgctt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30299976 |
gagtggaattgatactttattctcagtgttgcactctgactcgatcttttttccttccgcaaaaacacttcacccgtttattaaagttaaaaagccgctt |
30300075 |
T |
 |
| Q |
121 |
catcactggacgtggactctataccatagttgacaacacacacttcacacttc |
173 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30300076 |
catcactcgacgtggact-----ccatagttgacaacacacacttcacacttc |
30300123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University