View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16631_low_14 (Length: 359)
Name: NF16631_low_14
Description: NF16631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16631_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 139 - 354
Target Start/End: Complemental strand, 43256904 - 43256689
Alignment:
| Q |
139 |
ttggtgatgatctatatagtgacgcaccttgtctcaaaaataaaatgaaatggcatcttgtgatgtgattgtcggtacgagataatgcacgtggtaactg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43256904 |
ttggtgatgatctatatagtgacgcaccttgtctcaaaaataaaatgaaatggcatcttgtgatgtgattgtcggtacgagataatgcacgtggtaactg |
43256805 |
T |
|
| Q |
239 |
tatgaaaatcaaaactaaaggagtcaacacaacatgtacacaacaagccaacaaacattggggagaacctatctcttttccatttttcaaaccctaatct |
338 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43256804 |
tatgaaaatgaaaactaaaggagtcaacacaacatgtacacaacaagccaacaaacattggggagaacctatcccttttccatttttcaaaccctaatct |
43256705 |
T |
|
| Q |
339 |
tcccacctttgcttct |
354 |
Q |
| |
|
|| ||||||| ||||| |
|
|
| T |
43256704 |
tcacaccttttcttct |
43256689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University