View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16631_low_27 (Length: 203)
Name: NF16631_low_27
Description: NF16631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16631_low_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 39394865 - 39395067
Alignment:
| Q |
1 |
agcaatggacgatttagcattcgcgctaaaagaagtggcaacagaagctaaccaagtgaaaacaaaactaaccttaagtcaagttgaactagaacacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394865 |
agcaatggacgatttagcattcgcactaaaagaagtggcaacagaagctaaccaagtgaaaacaaaactaaccttaagtcaagttgaactagaacacaca |
39394964 |
T |
 |
| Q |
101 |
aaaggcgatgctgagcgttggaaaacgatgttagaaagcacagaagagaagtacaaagagcatctagacgcgacaagaaaagaagctgagaggttcaaaa |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394965 |
aaaggcgacgctgagcgttggaaaacgatgttagaaagcacagaagagaagtacaaagagcttctagacgcgacaagaaaagaagctgagaggttcaaaa |
39395064 |
T |
 |
| Q |
201 |
aca |
203 |
Q |
| |
|
||| |
|
|
| T |
39395065 |
aca |
39395067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University