View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_high_63 (Length: 281)
Name: NF16632_high_63
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_high_63 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 27 - 281
Target Start/End: Complemental strand, 6135612 - 6135360
Alignment:
| Q |
27 |
attcacaagtcattatactttaaagtgtaattatgacaacggttaactaataagaacaactttataaagaatacggtgtccaagtttcgcaaaatactac |
126 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6135612 |
attctcaagtcattatactttaaagtgtaattttgacaacggttaactaataagaacaactttataaagaatacggtgtccaagtttcgcaaaa-actac |
6135514 |
T |
|
| Q |
127 |
tcggatttaggagctatccttttagattgtcatagaatctatattcaacattttgtaaactacggattgagtttactaggatacatgccaacgagactgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
6135513 |
tcggatttaggagctatccttttagattgtcatagaatctatattcgacattttgtaaactacggattgagtttactaggatacat-ccaatgagactgc |
6135415 |
T |
|
| Q |
227 |
ccacactttagctaaggcagctacatcccttactaatttccgctcattaactgat |
281 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6135414 |
ccacactttagctaaggcagctacatctcttactaatttccgctcattaactgat |
6135360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University