View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16632_high_80 (Length: 236)

Name: NF16632_high_80
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16632_high_80
NF16632_high_80
[»] chr4 (1 HSPs)
chr4 (1-220)||(56469586-56469805)


Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 56469586 - 56469805
Alignment:
1 ccaaggaaggatgcagctcccaaaagtgcaaacaaacccacatccaaaactgtaaatggacttaacagacttccagcaacacgcccatatgaagcccctg 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56469586 ccaaggaaggatgcagcacccaaaagtgcaaacaaacccacatccaaaactgtaaatggacttaacagacttccagcaacacgcccatatgaagcccctg 56469685  T
101 ctagtatcactggaataaacaaccctgagggaattgcgatgccataagtaatgattccaaggaagtatattgccacaaagaatatcaggagactggagag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56469686 ctagtatcactggaataaacaaccctgagggaattgcgatgccataagtaatgattccaaggaagtatattgccacaaagaatatcaggagactggagag 56469785  T
201 ctggaatcttttgttagagc 220  Q
    |||||||||||||| |||||    
56469786 ctggaatcttttgtgagagc 56469805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University