View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_high_89 (Length: 211)
Name: NF16632_high_89
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_high_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 26001769 - 26001946
Alignment:
| Q |
20 |
cttggttattcgcttaatgcgtttcggttttcgaatttgagtttcgtgaatgctgattcgccacgaaggagtaggatggtgaggctgcagctcaatgctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26001769 |
cttggttattcgcttaatgcgtttcggttttcgaatttgagtttcgtgaatgctgattcgccacgaaggagtaggatggtgaggttgcagctcaatgctg |
26001868 |
T |
|
| Q |
120 |
atgaaaccaagaggttgcttgatgtgagtcactatcactctctcttttacgtttcgtttcgttgattatgtttcattt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
26001869 |
atgaaaccaagaggttgcttgatgtgagtcactatcactctctcttttacgtttcctttcgttaattatgttacattt |
26001946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University