View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_39 (Length: 375)
Name: NF16632_low_39
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 16 - 361
Target Start/End: Complemental strand, 40447681 - 40447336
Alignment:
| Q |
16 |
ggagcaagtgaaaatgttggaggagcaaagtaaaagtgtagaaccagttgtggttgtgaagaaactgtctgaactgtcttcagatgaagatgtttcggac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447681 |
ggagcaagtgaaaatgttggaggagcaaagtaaaagtgtagaaccagttgtggttgtgaagaaactgtctgaactgtcttcagatgaagatgtttcggac |
40447582 |
T |
 |
| Q |
116 |
acttcgtcaaattcatgtaatggaaactctgatgaaacatcaaaaacaaatctgtcactgcctgaagttgaagctagcttgtcggggaagaatgtgctga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447581 |
acttcgtcaaattcatgtaatggaaactctgatgaaacatcaaaaacaaatctgtcactgcctgaagttgaagctagcttgtcggggaagaatgtgctga |
40447482 |
T |
 |
| Q |
216 |
tccgaatcctctgtgagaaagataaggcagtgatggtgaatgtatatagagaaatagagaaacttcatctcttggttatcaatgctagttccttttcatt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447481 |
tccgaatcctctgtgagaaagataaggcagtgatggtgaatgtatatagagaaatagagaaacttcatctcttggttatcaatgctagttccttttcatt |
40447382 |
T |
 |
| Q |
316 |
tggttcctctgctctggccataaccatcattgcccaggtacaattt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40447381 |
tggttcctctgctctggccataaccatcattgcccaggtacaattt |
40447336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University