View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_41 (Length: 366)
Name: NF16632_low_41
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 11 - 349
Target Start/End: Complemental strand, 43366365 - 43366022
Alignment:
| Q |
11 |
cagagaacaggggtaagctaagcttctttattaatgaactgtg-catttgtttgtttttgcaatccttttgatcaaataaata----taaaggaaggagt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43366365 |
cagagaacaggggtaagctaagcttctttattaatgaactgtggcatttgtttgtttttgcaatccttttgatcaaataaataaatataaaggaaggagt |
43366266 |
T |
 |
| Q |
106 |
tcagtgaggttaaagtattacttggaatatgtatatctttctttatgtaaccaaattgttttatttaagcatgaatagttcttccatttcattagtagac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366265 |
tcagtgaggttaaagtattacttggaatatgtatatctttctttatgtaaccaattttttttatttaagcatgaatagttcttccatttcattagtagac |
43366166 |
T |
 |
| Q |
206 |
ataattgcattctgagtactaatataactatgctgcaatctaaaacatgtaatatgtaatatgctataactttatttcatagagtgggaccgtggtcatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43366165 |
ataattgcattctgagtactaatataactatgctgcaatctaaaacatgtaatatgtaatatgctataactttatttcatagagtgggaccctggtcatt |
43366066 |
T |
 |
| Q |
306 |
tgcaaaaaagtataggatgaaatttctacccaataattataggt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366065 |
tgcaaaaaagtataggatgaaatttctacccaataattataggt |
43366022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University