View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_52 (Length: 337)
Name: NF16632_low_52
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 44908417 - 44908110
Alignment:
| Q |
19 |
agagctagattcaaaaaataaatctagctagccatgaatcgataaaccatgatatgcttgtatgtctctccaggcttaacaatctgagatggaaagttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908417 |
agagctagattcaaaaaataaatctagctagccatgaatcgataaaccatgatatgcttgtatgtctctccaggcttaacaatctgagatggaaagttag |
44908318 |
T |
 |
| Q |
119 |
gcttattcacagaatctgggtaaccttgtgtctccaaagcaatgccaccatacttgtgatatgtagctccatcctttcctttagtatcagtcaacattcc |
218 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908317 |
gcttattcacagaatctgggaaaccctgtgtctccaaagcaatgccaccatacttgtgatatgtagctccatcctttcctttagtatcagtcaacattcc |
44908218 |
T |
 |
| Q |
219 |
actagtatagtattgcaatccaacttggtttgaccacaactccattttcc-ttcctgagacaggttctttcactatacaaaccttggttaaatgattttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44908217 |
actagtatagtattgcaatccaacttggtttgaccacaactccattttcctttcctgagacaggttctttcactatacaaaccttggttaaatgattttg |
44908118 |
T |
 |
| Q |
318 |
accattca |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
44908117 |
accattca |
44908110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University