View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16632_low_55 (Length: 319)

Name: NF16632_low_55
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16632_low_55
NF16632_low_55
[»] chr5 (2 HSPs)
chr5 (104-309)||(27204751-27204956)
chr5 (46-108)||(27203426-27203488)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 104 - 309
Target Start/End: Original strand, 27204751 - 27204956
Alignment:
104 agaaagagccaaagatgatctgcaccaacactaacaatgcaacctgaattaaccactttagaatagatgttacgatccatgtgctgccagcgttcacctc 203  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
27204751 agaaagaaccaaagatgatctgcaccaacactaacaatgcaacctgaattaaccactttggaatagacgttacgatccatgtgctgccagcgttcacctc 27204850  T
204 tttagtatgtttttctgttttctgtatccgtgtattgtgtctgtagtgtgcaatatcaactatgaagcactttagttacactctgttgcacctttctgca 303  Q
    ||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||    
27204851 tttagtatgtttttctgttttttgtattcgtgtattgtgtctgtagtgtgtaatatcaactatgaagcactttcgttacattctgttgcacctttctgca 27204950  T
304 cctttg 309  Q
    ||||||    
27204951 cctttg 27204956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 46 - 108
Target Start/End: Original strand, 27203426 - 27203488
Alignment:
46 aagttgcaccgtttgtgatggtacatgatccaaataacaatgaggttgaggtggcagtagaaa 108  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
27203426 aagttgcaccgtttgtgatggtacatgatccaaataacaatgagattgaggtggcagtagaaa 27203488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University