View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_81 (Length: 243)
Name: NF16632_low_81
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 39936755 - 39936543
Alignment:
| Q |
22 |
aatgttccaccactggctgatggtggcatggtgcaagcttactagggtatcttgtttaacaaacaatttattaaatgagcagatgctaagtttatccgcc |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936755 |
aatgttccaccactggccgatggtggcatggtgcaagcttactagggtatcttgtttaacaaacaatttattaaatgagcagatgctaagtttatccgcc |
39936656 |
T |
 |
| Q |
122 |
taaacaatttatgaacatagagtataatatactacttgaaaatgaatttataatacaaactcaaggtgaggaaaaactgaagaatgtgttcacccaaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936655 |
taaacaatttatgaacatagagtataatatactacttgaaaatgaatttataatacaaactcaaggtgaggaaaaactgaagaatgtgttcacccaaaaa |
39936556 |
T |
 |
| Q |
222 |
agaataatctacc |
234 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
39936555 |
agaagaatctacc |
39936543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University