View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_88 (Length: 237)
Name: NF16632_low_88
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_88 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 24705577 - 24705361
Alignment:
| Q |
1 |
tctacgattattttatagtaactaatatacatcgagaaatcagttggacatgcaatgtggattctctcctcccaatcagactttaatttattcttactta |
100 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||||||||||||| |||| |||| || ||||||||||| |||||||||||| ||| ||| || |
|
|
| T |
24705577 |
tctacggttattttataataattaatatacatcgagaaatcagttagacacgcaacgtagattctctcctttcaatcagactttc-----ttcatacgta |
24705483 |
T |
|
| Q |
101 |
agagtaaaaaacttagaatctataaccacttaagtatctcaaatctcatgcaacttgtataatttaattgatgccatagactcaaattgataccacaaag |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24705482 |
agagtaaaaaaattagaatctataaccacttaagtatctcaaatctcatgcaacttacataatttaattgataccatagactcaaattgataccacaaag |
24705383 |
T |
|
| Q |
201 |
atcacacgggttcgatataatt |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
24705382 |
atcacacgtgttcgatataatt |
24705361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University