View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16632_low_91 (Length: 233)
Name: NF16632_low_91
Description: NF16632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16632_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 53 - 118
Target Start/End: Original strand, 5276962 - 5277027
Alignment:
| Q |
53 |
ttttctgagttggaaacaaaactccctagttcagtgttcgtttcacatatctcattttctccttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5276962 |
ttttctgagttggaaacaaaactccctagttcagtgttcgtttcacatatttcattttctccttgt |
5277027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 12288891 - 12288840
Alignment:
| Q |
174 |
agtgaacctacgatgcctttatgcattgtagcattcacttatttttcatttc |
225 |
Q |
| |
|
||||||||||| || ||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
12288891 |
agtgaacctacaattcctctatacattgtagcattcacttctttttcatttc |
12288840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University