View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_high_5 (Length: 307)
Name: NF16633_high_5
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 11 - 293
Target Start/End: Complemental strand, 21592879 - 21592597
Alignment:
| Q |
11 |
atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592879 |
atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc |
21592780 |
T |
 |
| Q |
111 |
ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatcttctgttgctgga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21592779 |
ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacacaaatcttctgttgctgga |
21592680 |
T |
 |
| Q |
211 |
tataatcgaagattgcataaactcgctttttcttcagatgaggaggaaatagcaaataaatctgacttgggtgaagaacataa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592679 |
tataatcgaagattgcataaactcgctttttcttcagatgaggaggaaatagcaaataaatctgacttgggtgaagaacataa |
21592597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 6e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 123 - 248
Target Start/End: Original strand, 42095134 - 42095259
Alignment:
| Q |
123 |
taattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatcttctgttgctggatataatcgaaga |
222 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| |||||||||| ||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42095134 |
taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttccggctcttcagtcaaatcttctgtttctggatataatcgaagg |
42095233 |
T |
 |
| Q |
223 |
ttgcataaactcgctttttcttcaga |
248 |
Q |
| |
|
| ||||||||| || ||||||||||| |
|
|
| T |
42095234 |
tcgcataaacttgccttttcttcaga |
42095259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 251 - 290
Target Start/End: Original strand, 42095371 - 42095410
Alignment:
| Q |
251 |
aggaggaaatagcaaataaatctgacttgggtgaagaaca |
290 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42095371 |
aggaggaaatagcagataaatctgacttgggtgaagaaca |
42095410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University