View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_low_11 (Length: 261)
Name: NF16633_low_11
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 7609954 - 7610096
Alignment:
| Q |
18 |
gcttgatcgatgaaattgtttctagaaaagaattataactcaacttatcacaaagaagctaaccacattttcttttcctctttagtcttccaaagggaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
7609954 |
gcttgatcgatgaaattgtttctagaaaagaattataactcaacttatcacaaagaagctaaccacattttcatttcctc-ttagtcttccaaagggaga |
7610052 |
T |
 |
| Q |
118 |
attatgtggaagttttttattgctagcttcattcacacctagga |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7610053 |
attatgtggaagttttttattgctagcttcattcacacctagga |
7610096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University