View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_low_13 (Length: 227)
Name: NF16633_low_13
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 181
Target Start/End: Complemental strand, 37497818 - 37497650
Alignment:
| Q |
13 |
cagagaccacaatgaaaatcttagttgagccctagtatcaattttctccctccaaatttcttttatgaaaaatttgcacagtagttacagtttgcatagc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497818 |
cagaaaccacaatgaaaatcttagttgagccctagtatcaattttctccctccaaatttcttttatgaaaaatttgcacagtagttacagtttgcatagc |
37497719 |
T |
 |
| Q |
113 |
gcaagaggcacaaaaaacatgcattcaagacacattttttgtccataatttaatttcagtatacaattg |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497718 |
gcaagcggcacaaaaaacatgcattcaagacacattttttgtccataatttaatttcagtatacaattg |
37497650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University