View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_low_16 (Length: 218)
Name: NF16633_low_16
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 50 - 193
Target Start/End: Complemental strand, 13592294 - 13592157
Alignment:
| Q |
50 |
atttcatcaacttgaaagtagtggactggttactgaaagtacatcatactctttctttatcgtaaagtggcatcgatcatagatagataatctgtccggt |
149 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13592294 |
atttcattaacttgaaagtagtggattggttaatgaaagtacatcatactctttctttatcgtaaagtggcatcgatcata----gataatctgtccggt |
13592199 |
T |
 |
| Q |
150 |
tgaaaatattgagtattgtgtcaatattcacagtagaataacta |
193 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13592198 |
tgaaaatattgagtat--tgtcaatattcacagtagaataacta |
13592157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 13600432 - 13600404
Alignment:
| Q |
1 |
tattttatcttattctagatattcattta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13600432 |
tattttatcttattctagatattcattta |
13600404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University