View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_low_5 (Length: 341)
Name: NF16633_low_5
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 5577666 - 5577475
Alignment:
| Q |
12 |
ataggctaggtatggttttttgtaatggacttttatagcgttttatgagttagtttgtgatggttgtgtgttaattttgccatatgtaggatattttgca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5577666 |
ataggctaggtatggttttttgtaatggacttttatagcgttttatgagttagtttgtgatgggtgtgtgttaattttgccatatgtaggatattttgca |
5577567 |
T |
|
| Q |
112 |
tgatttgtggttgattgtgaactgcatgtgtgaattttttcgctttaatgaaatgaggtgtatatattgttttgatagatttgaaatcacgg |
203 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5577566 |
tgatttgtggttgattgtgaactgcgtatgtgaattttttcgctttaatgaaatgaggtgtatatattgttttgatagatttgaaatcacgg |
5577475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 279 - 317
Target Start/End: Complemental strand, 5577401 - 5577363
Alignment:
| Q |
279 |
aatggtggaactgaaattcctatatgccccagtagagag |
317 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5577401 |
aatgggggaactgaaattcctatatgccccagtagagag |
5577363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 5936335 - 5936269
Alignment:
| Q |
51 |
gttttatgagttagtttgtgatggttgtgtgttaattttgccatatgtaggatattttgcatgattt |
117 |
Q |
| |
|
||||| ||||||| ||||| |||| | |||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
5936335 |
gttttgtgagttaatttgttatgggtatgtgttaattttgctatatgtagtatcttttgcatgattt |
5936269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University