View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16633_low_6 (Length: 309)
Name: NF16633_low_6
Description: NF16633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16633_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 167 - 292
Target Start/End: Complemental strand, 7474788 - 7474663
Alignment:
| Q |
167 |
ttgaaggaatgaattacctaattggtggtggcggaggtttgtttttgagcgtaattaggaggagagtagacgagagcagccaccatagcagctggaagca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474788 |
ttgaaggaatgaattacctaattggtggtggcggaggtttgtttttgagcgtaattaggaggagagtagacgagagcagccaccatagcagctggaagca |
7474689 |
T |
|
| Q |
267 |
caccgaatctcgccaacgctgccact |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7474688 |
caccgaatctcgccaacgctgccact |
7474663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 7474941 - 7474874
Alignment:
| Q |
14 |
aatactaaatggcctttagcaaagttttaatcagtaataatttcataacctaaattaattattcactc |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474941 |
aatactaaatggcctttagcaaagttttaatcagtaataatttcataacctaaattaattattcactc |
7474874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University