View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16634_low_33 (Length: 227)
Name: NF16634_low_33
Description: NF16634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16634_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 221
Target Start/End: Complemental strand, 46453486 - 46453378
Alignment:
| Q |
113 |
ggaccttgacgaggagcttgaggtagatatcattggatttaggttctgatcgtttggtgtttttgctcttacccccagctttgagatcgatcccctacat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453486 |
ggaccttgacgaggagcttgaggtagatatcattggatttaggttctgttcgtttggtgtttttgctcttacccccagctttgagatcgatcccctacat |
46453387 |
T |
|
| Q |
213 |
attaaattc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
46453386 |
attaaattc |
46453378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 46453606 - 46453561
Alignment:
| Q |
1 |
catcatcgtcacgaaaaatcagaacacattatagatctcgatgttc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46453606 |
catcatcgtcacgaaaaatcagaacacattatagatctcgatgttc |
46453561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 44438375 - 44438338
Alignment:
| Q |
115 |
accttgacgaggagcttgaggtagatatcattggattt |
152 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
44438375 |
accttaacgagaagcttgaggtagatatcattggattt |
44438338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 221
Target Start/End: Complemental strand, 37145995 - 37145901
Alignment:
| Q |
127 |
agcttgaggtagatatcattggatttaggttctgatcgtttggtgtttttgctcttacccccagctttgagatcgatcccctacatattaaattc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||| || ||| || |||||| ||||||| || || || |||||||| ||||||| ||| ||||| |
|
|
| T |
37145995 |
agcttgagatagatatcattggattttggtgctgttctttttgtttttttgttcttacctcctgccttaagatcgataccctacaaattcaattc |
37145901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University