View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16635_high_20 (Length: 249)
Name: NF16635_high_20
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16635_high_20 |
 |  |
|
| [»] scaffold0237 (1 HSPs) |
 |  |  |
|
| [»] scaffold0153 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0940 (1 HSPs) |
 |  |  |
|
| [»] scaffold0839 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0042 (1 HSPs) |
 |  |  |
|
| [»] scaffold1521 (1 HSPs) |
 |  |  |
|
| [»] scaffold0492 (1 HSPs) |
 |  |  |
|
| [»] scaffold0383 (1 HSPs) |
 |  |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 233
Target Start/End: Original strand, 378914 - 379115
Alignment:
| Q |
25 |
cttttaaaatctcaatccaatacaccccttaaatacttcataaccccaaattgctttggtcnnnnnnnnnnnnnncaccaattgctagcaaagatcaatt |
124 |
Q |
| |
|
||||||||||| |||||||||| |||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
378914 |
cttttaaaatcccaatccaatataccc--taagtacttcataaccccaaattgctttggt-----aaaaaaaaaacaccaattgctagcaaagatcaatt |
379006 |
T |
 |
| Q |
125 |
aacaatatttctttgtagaaaaagaaacaactgtgatgaattgacccacttgatatagacctttgaacaccaattatatgagggagtataacatgttcca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
379007 |
aacaatatttctttgtagaaaaagaaacaactgtgatgaattgacccacttgatatagacctttgaacaccaattatatgagggagtataacatgttcca |
379106 |
T |
 |
| Q |
225 |
agtgcctgt |
233 |
Q |
| |
|
| ||||||| |
|
|
| T |
379107 |
attgcctgt |
379115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 40411459 - 40411510
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40411459 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacaccccctaaat |
40411510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 11632731 - 11632686
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11632731 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
11632686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 10553484 - 10553437
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccctt |
54 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
10553484 |
tttttctatcaaaacagtctttttaaatctcaatccaatacacccctt |
10553437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 10553777 - 10553823
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
10553777 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacatccct |
10553823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 13717144 - 13717190
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13717144 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccct |
13717190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 4239625 - 4239580
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4239625 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
4239580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 13949846 - 13949805
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
13949846 |
tttttctatcaaaacagtcttttaaaatctcaatccaataca |
13949805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 13999259 - 13999214
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13999259 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
13999214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 18676976 - 18676939
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaa |
44 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18676976 |
tttttctatcaaaatagtcttttaaaatctcaatccaa |
18676939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 26629557 - 26629516
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
26629557 |
tttttcaatcaaaatagtcttttaaaatctcaatccaataca |
26629516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 40012862 - 40012817
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40012862 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
40012817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 6827987 - 6827947
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
6827987 |
aaaataatcttttaaaatctcaatccaatacaccccctaaa |
6827947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 5950463 - 5950506
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5950463 |
tttttttattaaaatagtcttttaaaatcataatccaatacacc |
5950506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 13926988 - 13927027
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13926988 |
tattaaaatagtcttttaaaatcctaatccaatacacccc |
13927027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 4549409 - 4549364
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
4549409 |
tttttttattaaaatagtcttttaaaatcctaatcgaatacacccc |
4549364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 17519567 - 17519604
Alignment:
| Q |
16 |
taaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
17519567 |
taaaatagtcttttaaaatcttaatccaatacatccct |
17519604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 39853401 - 39853446
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39853401 |
tttttatattaaaatagtcttttaaaattctaatccaatacacccc |
39853446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 31)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 30111834 - 30111879
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30111834 |
tttttctatcaaaatagtcttttaaaatctcaatccaatacacccc |
30111879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 152902 - 152947
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
152902 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
152947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 510697 - 510742
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
510697 |
tttttttattaaaatagtcttttaaaatcccaatccaatacacccc |
510742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 28343359 - 28343404
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28343359 |
tttttttattaaaatagtcttttaaaatcccaatccaatacacccc |
28343404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 12741423 - 12741467
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12741423 |
tttttttattaaaatagtcttttaaaatcttaatccaatacaccc |
12741467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 39300461 - 39300426
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300461 |
aaaatagtcttttaaaatctcaatccaatacacccc |
39300426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 21068407 - 21068457
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
21068407 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaa |
21068457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 27417693 - 27417651
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
27417693 |
tttttctatcaaaatactcttttaaaatctcaatccaatacac |
27417651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 29894006 - 29894056
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29894006 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccataaa |
29894056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 3023969 - 3024018
Alignment:
| Q |
3 |
aaaatttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3023969 |
aaaacttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
3024018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 12252431 - 12252386
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
12252431 |
tttttctatcaaaacaatcttttaaaatctcaatccaatacacccc |
12252386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 23102340 - 23102385
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23102340 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
23102385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 33475578 - 33475623
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
33475578 |
tttttctatcaaaacagtcttttaaaatctcaatcaaatacacccc |
33475623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 39785147 - 39785192
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39785147 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
39785192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 47912569 - 47912524
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
47912569 |
tttttctatcaaaacagtcttttaaaatctcaatccaatatacccc |
47912524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 49
Target Start/End: Original strand, 32884814 - 32884850
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32884814 |
tattaaaatagtcttttaaaatcttaatccaatacac |
32884850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 37328876 - 37328924
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccctta |
55 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37328876 |
tttttttattaaaatagtcttttaaaattctaatccaatacacccctta |
37328924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 29613949 - 29613906
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29613949 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacc |
29613906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 12893153 - 12893103
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||| |||| ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
12893153 |
tttttttattgaaatagtattttaaaatcctaatccaatacaccccttaaa |
12893103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 18839343 - 18839389
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||| |||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18839343 |
tttttttattaaaataatcttttaaaatcctaatccaatacacccct |
18839389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 32631578 - 32631612
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
32631578 |
aaaatagtctttcaaaatctcaatccaatacaccc |
32631612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 37971551 - 37971509
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37971551 |
tttttttattaaaatagtcttttaaaatcctaatccaatacac |
37971509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 30823636 - 30823681
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
30823636 |
tttttttattaaaatagtcttttaaaatcctaattcaatacacccc |
30823681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 39029102 - 39029147
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39029102 |
tttttttattaaaataatcttttaaaatcctaatccaatacacccc |
39029147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 40459878 - 40459833
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40459878 |
tttttttattaaaatagtcttttaaaattctaatccaatacacccc |
40459833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 43056733 - 43056688
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
43056733 |
tttttctatcaaaacattcttttaaaatctcaattcaatacacccc |
43056688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 48136407 - 48136362
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
48136407 |
tttttttattaaaatagtcttttaaaatcctaatccaatatacccc |
48136362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 9881445 - 9881401
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9881445 |
ttttttattaaaattgtcttttaaaatcctaatccaatacacccc |
9881401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 52
Target Start/End: Complemental strand, 46197133 - 46197105
Alignment:
| Q |
24 |
tcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46197133 |
tcttttaaaatctcaatccaatacacccc |
46197105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 46405346 - 46405302
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
46405346 |
tttttttattaaaatagtcttttaaaatcctaatctaatacaccc |
46405302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 47032371 - 47032399
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47032371 |
aaaatagtcttttaaaatctcaatccaat |
47032399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 36)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 36054055 - 36054010
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36054055 |
tttttctatcaaaatagtcttttaaaatctcaatccaatacacccc |
36054010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 24149882 - 24149831
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24149882 |
tttttctatcaaaatagtcttttaaaatcttaatccaatacaccccctaaat |
24149831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 26004893 - 26004848
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26004893 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
26004848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 26556908 - 26556953
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26556908 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
26556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 30589886 - 30589931
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30589886 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
30589931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 38628865 - 38628820
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38628865 |
tttttctatcaaaagagtcttttaaaatctcaatccaatacacccc |
38628820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 50902463 - 50902418
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50902463 |
tttttttattaaaatagtcttttaaaatcttaatccaatacacccc |
50902418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 26292608 - 26292564
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26292608 |
ttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
26292564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 27593998 - 27594034
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27593998 |
aaaatagtcttttaaaatctcaatccaatacacccct |
27594034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 11432596 - 11432647
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
11432596 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaat |
11432647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 33417106 - 33417157
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacac-cccttaaa |
57 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33417106 |
tttttcaatcaaaatagtcttttaaaatctcaatccaatacactcccttaaa |
33417157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 43152080 - 43152114
Alignment:
| Q |
16 |
taaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43152080 |
taaaatagtcttttaaaatctcaatccaatacacc |
43152114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 2124750 - 2124705
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2124750 |
tttttttatcaaaacagtcttttaaaatctcaatccaatacacccc |
2124705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 10728170 - 10728125
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10728170 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
10728125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 17947269 - 17947314
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17947269 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
17947314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 27239372 - 27239327
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27239372 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
27239327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 31645409 - 31645364
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31645409 |
tttttttattaaaattgtcttttaaaatcttaatccaatacacccc |
31645364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 36673305 - 36673260
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36673305 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
36673260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 6783233 - 6783189
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
6783233 |
tttttttatcaaaatagtcttttaaaatttcaatccaatacaccc |
6783189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 19551193 - 19551153
Alignment:
| Q |
11 |
tctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
19551193 |
tctatcaaaacagtcttttaaaatctcaatccaatacaccc |
19551153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 28845681 - 28845721
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
28845681 |
aaaatagtcttttaaaacctcaatccaatacaccccctaaa |
28845721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 44905001 - 44904961
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44905001 |
ttttttattaaaatagtcttttaaaatcttaatccaataca |
44904961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 20833947 - 20833990
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20833947 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacc |
20833990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 23754592 - 23754635
Alignment:
| Q |
11 |
tctattaaaatagtcttttaaaatctcaatccaatacacccctt |
54 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23754592 |
tctatcaacataatcttttaaaatctcaatccaatacacccctt |
23754635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 46223351 - 46223308
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46223351 |
tttttctatcaaaacagtcttttaaaatctcaattcaatacacc |
46223308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 50761267 - 50761220
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccctt |
54 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
50761267 |
tttttttattaaaatagtcttttaatatcctaatccaatacacccctt |
50761220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 10661237 - 10661278
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10661237 |
tttttttattaaaatagtcttttaaaatcctaatccaataca |
10661278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 18750684 - 18750729
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18750684 |
tttttttattaaaatagtcttttaaaatcctaattcaatacacccc |
18750729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 23360618 - 23360663
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
23360618 |
tttttatatcaaaacagtcttttagaatctcaatccaatacacccc |
23360663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 23367458 - 23367503
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
23367458 |
tttttatatcaaaacagtcttttagaatctcaatccaatacacccc |
23367503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 50
Target Start/End: Original strand, 37455891 - 37455928
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37455891 |
tattaaaatagtcttttaaaatcctaatccaatacacc |
37455928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 45254600 - 45254555
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
45254600 |
tttttttattaaaatagtcttttaaaatcctaatctaatacacccc |
45254555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 52617132 - 52617087
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
52617132 |
tttttttattaaaattgtcttttaaaatcctaatccaatacacccc |
52617087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 54629902 - 54629947
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
54629902 |
tttttttattaaaattgtcttttaaaatcctaatccaatacacccc |
54629947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 48380199 - 48380243
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48380199 |
tttttttattaaaatagtcttttaaaattctaatccaatacaccc |
48380243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 58
Target Start/End: Original strand, 52811408 - 52811444
Alignment:
| Q |
22 |
agtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52811408 |
agtcttttaaaatcttaattcaatacaccccttaaat |
52811444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 30)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Complemental strand, 30381857 - 30381818
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccccttaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30381857 |
aaaatagtcttttaaaatctcaatccaatacaccccttaa |
30381818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 4656117 - 4656167
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4656117 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacaccccctaaa |
4656167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 7149075 - 7149120
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7149075 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
7149120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 9458548 - 9458593
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9458548 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
9458593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 40264320 - 40264275
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40264320 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
40264275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 18957879 - 18957828
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
18957879 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaat |
18957828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 34893407 - 34893458
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
34893407 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaat |
34893458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 37566556 - 37566521
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37566556 |
aaaatagtcttttaaaatctcaatccaatacacccc |
37566521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 41385913 - 41385870
Alignment:
| Q |
9 |
tttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41385913 |
tttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
41385870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 42366941 - 42366984
Alignment:
| Q |
10 |
ttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42366941 |
ttctatcaaaatagtcatttaaaatctcaatccaatacacccct |
42366984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 32498940 - 32498990
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
32498940 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaa |
32498990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 37857926 - 37857972
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37857926 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccct |
37857972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 10795420 - 10795379
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
10795420 |
tttttctatcaaaacagtcttttaaaatctcaatccaataca |
10795379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 14781293 - 14781248
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14781293 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
14781248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 39466679 - 39466634
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
39466679 |
tttttttattaaaataatcttttaaaatcttaatccaatacacccc |
39466634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 17791611 - 17791651
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
17791611 |
ttttcaatcaaaatagtcttttaaaatctcaatccaataca |
17791651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 38805969 - 38805929
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatac |
47 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38805969 |
tttttctaccaaaatagtcttttaaaatctcaatccaatac |
38805929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 44724942 - 44724898
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44724942 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccc |
44724898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 4302147 - 4302112
Alignment:
| Q |
16 |
taaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4302147 |
taaaatagtcttttaaattctcaatccaatacaccc |
4302112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 9287651 - 9287608
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9287651 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacc |
9287608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 4030488 - 4030442
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4030488 |
tttttttattaaaatagtcttttaaaatcctaatctaatacacccct |
4030442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 56
Target Start/End: Complemental strand, 8502670 - 8502636
Alignment:
| Q |
22 |
agtcttttaaaatctcaatccaatacaccccttaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8502670 |
agtcttttaaaatctcaatccaatacatcccttaa |
8502636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 43604420 - 43604382
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaat |
45 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43604420 |
tttttctatcaaaacagtcttttaaaatctcaatccaat |
43604382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 1605845 - 1605804
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
1605845 |
tttttctatcaaaacagtattttaaaatctcaatccaataca |
1605804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 10128314 - 10128355
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
10128314 |
aaaataatcttttaaattctcaatccaatacaccccctaaat |
10128355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 18305122 - 18305077
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
18305122 |
tttttttattaaaattgtcttttaaaatcctaatccaatacacccc |
18305077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 19717024 - 19716983
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19717024 |
tttttttattaaaatagtcttttaaaatcctaatccaataca |
19716983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 42304786 - 42304745
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42304786 |
tttttttattaaaatagtcttttaaaatcctaatccaataca |
42304745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 40012333 - 40012297
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
40012333 |
tattaaaatagtattttaaaatcttaatccaatacac |
40012297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 45
Target Start/End: Complemental strand, 43307693 - 43307661
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaat |
45 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
43307693 |
tattaaaatagtcttttaaaatcttaatccaat |
43307661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 24192708 - 24192657
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24192708 |
tttttttatcaaaatagtcttttaaaatctcaatccaatacaccccctaaat |
24192657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 28845627 - 28845676
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaa |
56 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28845627 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccccttaa |
28845676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 29941930 - 29941975
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29941930 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
29941975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 45547956 - 45548001
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45547956 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
45548001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 6288599 - 6288553
Alignment:
| Q |
9 |
tttctattaaaatagtcttttaaaatctcaatccaatacacccctta |
55 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
6288599 |
tttctatcaaaacagtcttttaaaatctcaatccaatccacccctta |
6288553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 24935326 - 24935292
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24935326 |
aaaatagtcttttaaaatctcaatccaatacaccc |
24935292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 25684019 - 25683985
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25684019 |
aaaatagtcttttaaaatctcaatccaatacaccc |
25683985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 214670 - 214625
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
214670 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
214625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 379959 - 380004
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
379959 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
380004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 7487002 - 7486957
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
7487002 |
tttttctatcaaaacggtcttttaaaatctcaatccaatacacccc |
7486957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 10658480 - 10658529
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
10658480 |
ttttttattaaaatagtcttttaaaatcctaatccaatacaccccctaaa |
10658529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 18178321 - 18178366
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18178321 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
18178366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 25289204 - 25289249
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25289204 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
25289249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 26789834 - 26789879
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26789834 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
26789879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 35171426 - 35171381
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
35171426 |
tttttctatcaaaacagtcttttaaaatctcaatccaacacacccc |
35171381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 11535725 - 11535760
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11535725 |
aaaatagtcttttaaaatctcaattcaatacacccc |
11535760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 30239200 - 30239161
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30239200 |
tattaaaatagtcttttaaaatcataatccaatacacccc |
30239161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 12135585 - 12135619
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12135585 |
aaaatagtctttcaaaatctcaatccaatacaccc |
12135619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 36599190 - 36599148
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
36599190 |
tttttctattaaaatagtcctttaaaatttcattccaatacac |
36599148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 33136646 - 33136691
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
33136646 |
tttttttattaaaattgtcttttaaaatcctaatccaatacacccc |
33136691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 20492 - 20447
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20492 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
20447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 33870 - 33825
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33870 |
tttttctatcaaaaaagtcttttaaaatctcaatccaatacacccc |
33825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 80838 - 80793
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
80838 |
tttttctatcaaaaaagtcttttaaaatctcaatccaatacacccc |
80793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 3109395 - 3109350
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3109395 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
3109350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 29864797 - 29864752
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29864797 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
29864752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 10008410 - 10008375
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10008410 |
aaaatagtcttttaaaatctcaatccaatacacccc |
10008375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 35165691 - 35165725
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165691 |
aaaatagtcttttaaaatctcaatccaatacaccc |
35165725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 6475788 - 6475743
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
6475788 |
tttttctatcaaaacagtcttttaaaatctcaattcaatacacccc |
6475743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 7498149 - 7498194
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7498149 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
7498194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 30384217 - 30384172
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30384217 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
30384172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 31068469 - 31068514
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31068469 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
31068514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 31896686 - 31896731
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31896686 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
31896731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 4199632 - 4199587
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
4199632 |
tttttttattaaaatagtgttttaaaatcctaatccaatacacccc |
4199587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 51
Target Start/End: Original strand, 5958074 - 5958103
Alignment:
| Q |
22 |
agtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5958074 |
agtcttttaaaatctcaatccaatacaccc |
5958103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 14261596 - 14261552
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
14261596 |
tttttttattaaaattgtcttttaaaatcataatccaatacaccc |
14261552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 27)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 42315923 - 42315968
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42315923 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
42315968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 47686862 - 47686907
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47686862 |
tttttttatcaaaatagtcttttaaaatctcaatccaatacacccc |
47686907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 388652 - 388612
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
388652 |
aaaatagtcttttaaaatctcaatccaatacaccccctaaa |
388612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 3434872 - 3434832
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatac |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3434872 |
tttttctattaaaatagtcttttaaaatctcaattcaatac |
3434832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 44930650 - 44930698
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccctta |
55 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44930650 |
tttttttatcaaaacagtcttttaaaatctcaatccaatacacccctta |
44930698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 7820988 - 7821035
Alignment:
| Q |
5 |
aatttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7820988 |
aatttttctatcaaatcagtcttttaaaatctcaatccaatacacccc |
7821035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 23988246 - 23988297
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaat |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
23988246 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccctaaaat |
23988297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 28846205 - 28846170
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28846205 |
aaaatagtcttttaaaatctcaatccaatacacccc |
28846170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 54510611 - 54510646
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54510611 |
aaaatagtcttttaaaatctcaatccaatacacccc |
54510646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 42217493 - 42217447
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
42217493 |
tttttctatcaaaacagtcttttaaaatctcaatcaaatacacccct |
42217447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 5442440 - 5442485
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5442440 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
5442485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 7809039 - 7809084
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7809039 |
tttttctatcaaaccagtcttttaaaatctcaatccaatacacccc |
7809084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 27769113 - 27769158
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27769113 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
27769158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 32683180 - 32683135
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32683180 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
32683135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 48262124 - 48262169
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48262124 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
48262169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 5117868 - 5117900
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5117868 |
aaaatagtcttttaaaatctcaatccaatacac |
5117900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 32323119 - 32323163
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32323119 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccc |
32323163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 8583046 - 8583008
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaat |
45 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8583046 |
tttttctatcaaaacagtcttttaaaatctcaatccaat |
8583008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 41726156 - 41726198
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41726156 |
ttttttattaaaatagtcttttaaaatcataatccaatacacc |
41726198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 5801762 - 5801803
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
5801762 |
tttttttattaaaatagttttttaaaatcttaatccaataca |
5801803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 37916857 - 37916902
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
37916857 |
tttttttattaaaatagtctcttaaaatcctaatccaatacacccc |
37916902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 50019240 - 50019285
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50019240 |
tttttttattaaaatagtcttttaaaattctaatccaatacacccc |
50019285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 54342196 - 54342241
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54342196 |
tttttttattaaaatagtcttttaaaattctaatccaatacacccc |
54342241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 29649175 - 29649131
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29649175 |
tttttttattaaaatagtcttttaaaatcctaatccaattcaccc |
29649131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 52
Target Start/End: Complemental strand, 44929904 - 44929876
Alignment:
| Q |
24 |
tcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44929904 |
tcttttaaaatctcaatccaatacacccc |
44929876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 49834017 - 49833973
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
49834017 |
tttttttattaaaatagtcttttaaaatcctaatccaatataccc |
49833973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 56399082 - 56399126
Alignment:
| Q |
9 |
tttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
56399082 |
tttctatcaaaacggtcttttaaaatctcaattcaatacacccct |
56399126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 24)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 26881861 - 26881820
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26881861 |
tttttctatcaaaatagtcttttaaaatctcaatccaataca |
26881820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 45319516 - 45319561
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45319516 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
45319561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 10897693 - 10897728
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10897693 |
aaaatagtcttttaaaatctcaatccaatacacccc |
10897728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 14389465 - 14389508
Alignment:
| Q |
9 |
tttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14389465 |
tttctatcaaaacagtcttttaaaatctcaatccaatacacccc |
14389508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 36403135 - 36403170
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36403135 |
aaaatagtcttttaaaatctcaatccaatacacccc |
36403170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 48176691 - 48176644
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccctt |
54 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48176691 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccctt |
48176644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 45535798 - 45535840
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
45535798 |
tttttctatcaaaacagtcttttaaaatctcaatccaatacac |
45535840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 57
Target Start/End: Original strand, 52706429 - 52706479
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaa |
57 |
Q |
| |
|
||||||||| |||| | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
52706429 |
tttttctatcaaaacattcttttaaaatctcaatccaatacaccccctaaa |
52706479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 6313625 - 6313670
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6313625 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
6313670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 9321664 - 9321619
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
9321664 |
tttttttattaaaatagtcttttaaaatcccaattcaatacacccc |
9321619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 25613141 - 25613186
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25613141 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
25613186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 28386603 - 28386558
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28386603 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
28386558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 29395583 - 29395538
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29395583 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
29395538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 33242496 - 33242461
Alignment:
| Q |
17 |
aaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33242496 |
aaaatagtcttttaaaatctcaatgcaatacacccc |
33242461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 46329023 - 46329062
Alignment:
| Q |
13 |
tattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46329023 |
tattaaaatagtcttttaaaatcctaatccaatacacccc |
46329062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 9832768 - 9832802
Alignment:
| Q |
18 |
aaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
9832768 |
aaatagtcttttaaaatctcaatctaatacacccc |
9832802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 49232033 - 49232079
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccct |
53 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
49232033 |
tttttttattaaaattgtcttttaaaatcctaatccaatacacccct |
49232079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 1087556 - 1087507
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaa |
56 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
1087556 |
tttttctaataaaatagtcctttaaaatccaaaaccaatacaccccttaa |
1087507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 8140021 - 8139980
Alignment:
| Q |
8 |
ttttctattaaaatagtcttttaaaatctcaatccaatacac |
49 |
Q |
| |
|
|||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
8140021 |
ttttatattaaaatagtcttttaaaattttaatccaatacac |
8139980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 9174936 - 9174969
Alignment:
| Q |
15 |
ttaaaatagtcttttaaaatctcaatccaataca |
48 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
9174936 |
ttaaaatagtcttttaaaatctcaatcaaataca |
9174969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 20111727 - 20111682
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
20111727 |
tttttttattaaaatagtcttttaaaatcgtaatcaaatacacccc |
20111682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 25830405 - 25830360
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25830405 |
tttttttattaaaatagtcttttaaaatcctaattcaatacacccc |
25830360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Original strand, 51702643 - 51702688
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
51702643 |
tttttttattaaaatagtcttttaaaatcctaatcctatacacccc |
51702688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 15835374 - 15835410
Alignment:
| Q |
16 |
taaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15835374 |
taaaatagtcttttaaaatcctaatccaatacacccc |
15835410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0940 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0940
Description:
Target: scaffold0940; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 3619 - 3574
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3619 |
tttttttattaaaatagtcttttaaaatcctaatccaatacacccc |
3574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0839 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0839
Description:
Target: scaffold0839; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 3158 - 3114
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
3158 |
tttttttattaaaatagtcttttaaaatcttaatctaatacaccc |
3114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 36445 - 36401
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccc |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36445 |
tttttttattaaaatagtcttttaaaatcctaatccaatacaccc |
36401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 21822 - 21865
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacc |
50 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
21822 |
tttttgtattaaaataatcttttaaaatcttaatccaatacacc |
21865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 57215 - 57170
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
57215 |
tttttttattaaaatagtcttttaaaattctaatccaatacacccc |
57170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1521 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1521
Description:
Target: scaffold1521; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 1337 - 1285
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaata |
59 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||| |||| |||||| |
|
|
| T |
1337 |
tttttttattaaaatagtcttttaaaatcctaattcaatactccccctaaata |
1285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 12094 - 12130
Alignment:
| Q |
16 |
taaaatagtcttttaaaatctcaatccaatacacccc |
52 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12094 |
taaaatagtcttttaaaatcctaatccaatacacccc |
12130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0383 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0383
Description:
Target: scaffold0383; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 16192 - 16140
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaata |
59 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||| |||| |||||| |
|
|
| T |
16192 |
tttttttattaaaatagtcttttaaaatcctaattcaatactccccctaaata |
16140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 29382 - 29434
Alignment:
| Q |
7 |
tttttctattaaaatagtcttttaaaatctcaatccaatacaccccttaaata |
59 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||| |||| |||||| |
|
|
| T |
29382 |
tttttttattaaaatagtcttttaaaatcctaattcaatactccccctaaata |
29434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University