View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16635_high_22 (Length: 235)
Name: NF16635_high_22
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16635_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 48946981 - 48946777
Alignment:
| Q |
18 |
acatttatgttagttatgtgatgtgagtaacttttatatatgcacatacatagtaccttcgctagtttccttgtggcatgtggtgtgttacttggtagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48946981 |
acatttatgttagttatgtgatgtgagtaacttttatatatgta------tagtaccttcgctagtttccttgtggcatgtggtgtgttacttggtagta |
48946888 |
T |
 |
| Q |
118 |
atttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcatcaaa-------ggtcatgtattagcacttctttatattgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48946887 |
atttgaaaagatgtctttgctttgaatttgttaccacatatctaaacatgtggaattcatcaaagtttaatggtcatgtattagcacttctttatattgc |
48946788 |
T |
 |
| Q |
211 |
ccttttcattt |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
48946787 |
ccttttcattt |
48946777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University