View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16635_high_4 (Length: 433)

Name: NF16635_high_4
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16635_high_4
NF16635_high_4
[»] chr4 (3 HSPs)
chr4 (156-418)||(35184779-35185039)
chr4 (156-294)||(4103951-4104089)
chr4 (170-212)||(47914909-47914951)
[»] chr8 (5 HSPs)
chr8 (156-294)||(15333706-15333844)
chr8 (156-294)||(15514075-15514213)
chr8 (156-294)||(15422802-15422940)
chr8 (156-294)||(18802638-18802776)
chr8 (163-294)||(14980086-14980215)
[»] chr6 (1 HSPs)
chr6 (156-294)||(14963267-14963405)
[»] chr7 (1 HSPs)
chr7 (156-274)||(48630971-48631089)
[»] chr5 (1 HSPs)
chr5 (156-294)||(21301313-21301445)
[»] scaffold0464 (1 HSPs)
scaffold0464 (153-294)||(3344-3485)
[»] chr1 (1 HSPs)
chr1 (357-417)||(1393582-1393642)
[»] scaffold0232 (2 HSPs)
scaffold0232 (170-212)||(21266-21308)
scaffold0232 (170-212)||(26349-26391)
[»] chr3 (1 HSPs)
chr3 (170-212)||(7190697-7190739)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 156 - 418
Target Start/End: Original strand, 35184779 - 35185039
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||| ||||||||||||||||||||| || |||||| ||    
35184779 tgcaagctgagattgattctcttaaggataaggcttcacaagttgatattttgaaggcgcaagttgctttcttaatgcaaatgcaagagcaaaattcgag 35184878  T
256 agacaaagaggtaaattttacaaaactattgctaaaacaatatgctcttttacnnnnnnnnnnnttagaggttgatatctgcaacaatccttaggctttt 355  Q
    |||||||||||||| ||||||||||||||||| |||||| | ||||||| |||           ||||| ||||||||||||||||| ||||||||||||    
35184879 agacaaagaggtaacttttacaaaactattgcaaaaacattctgctcttgtac--aaaaaaaaattagaagttgatatctgcaacaacccttaggctttt 35184976  T
356 ctttgtatgttgtagctttgcgaaattaagtacatgatttggataatagagactcatagtttt 418  Q
    ||||||||||||| |||||||||||||||||  ||||||||||||||||| ||||||||||||    
35184977 ctttgtatgttgttgctttgcgaaattaagtgtatgatttggataatagatactcatagtttt 35185039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 4103951 - 4104089
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||| | | ||||| |||| ||||||||||||||||||| |||||||||    
4103951 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaatgcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctag 4104050  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
4104051 agacaaagaggtaacttttaccaaactattgcaaaaaca 4104089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 47914909 - 47914951
Alignment:
170 gattctcttaaggataaggcttcacaagttgatatcttgaagg 212  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
47914909 gattcacttaaggataaggcttcacaagttgatatcttgaagg 47914951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 15333706 - 15333844
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||| | ||||| |||| ||||||||||||||||||| |||||||||    
15333706 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaaggcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctag 15333805  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
15333806 agacaaagaggtaacttttaccaaactattgcaaaaaca 15333844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 15514075 - 15514213
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||| | ||||| |||| ||||||||||||||||||| |||||||||    
15514075 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaaggcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctag 15514174  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
15514175 agacaaagaggtaacttttaccaaactattgcaaaaaca 15514213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 15422802 - 15422940
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||   ||||| |||| ||||||||||||||||||| |||||||||    
15422802 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaaggcacaagttgcttttttaatgcaaatgcaagtgcaaaattctag 15422901  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
15422902 agacaaagaggtaacttttaccaaactattgcaaaaaca 15422940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 18802638 - 18802776
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||| | | ||||| |||| ||||||||||||||||||| |||||||||    
18802638 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaatgcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctag 18802737  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| | |||| |||||||||| ||||||    
18802738 agacaaagaggtaactcttaccaaactattgcaaaaaca 18802776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 163 - 294
Target Start/End: Complemental strand, 14980215 - 14980086
Alignment:
163 tgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctagagacaaa 262  Q
    ||||||||||||||||||||| |||||||||||||||||| ||||||| | | ||||| |||| ||||||||||||||||||| ||||||||||||||||    
14980215 tgagattgattctcttaaggagaaggcttcacaagttgatttcttgaacgcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctagagacaaa 14980116  T
263 gaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||  | ||||| |||||||||| ||||||    
14980115 gaggt--actttaccaaactattgcaaaaaca 14980086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 91; Significance: 6e-44; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 156 - 294
Target Start/End: Original strand, 14963267 - 14963405
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||| | | ||||| |||| ||||||||||||||||||| |||||||||    
14963267 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaatgcgcaagttgcttttttaatgcaaatgcaagtgcaaaattctag 14963366  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
14963367 agacaaagaggtaacttttaccaaactattgcaaaaaca 14963405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 156 - 274
Target Start/End: Original strand, 48630971 - 48631089
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||| | | ||||| |||| |||||||||||||||| || |||||||||    
48630971 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaacgcgcaagttgcttttttaatgcaaatgcaagcgcaaaattctag 48631070  T
256 agacaaagaggtaaatttt 274  Q
    |||||||||||||| ||||    
48631071 agacaaagaggtaactttt 48631089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 156 - 294
Target Start/End: Complemental strand, 21301445 - 21301313
Alignment:
156 tgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattctag 255  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||| | ||||| |||| ||      ||||||||||| |||||| ||    
21301445 tgcaagctgagattgattctcttaaggagaaggcttcacaagttgatttcttgaaggcgcaagttgctttttt------aatgcaagtgcaaaattcaag 21301352  T
256 agacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||||||||| |||||| |||||||||| ||||||    
21301351 agacaaagaggtaacttttaccaaactattgcaaaaaca 21301313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0464 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0464
Description:

Target: scaffold0464; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 153 - 294
Target Start/End: Original strand, 3344 - 3485
Alignment:
153 atgtgcaagttgagattgattctcttaaggataaggcttcacaagttgatatcttgaaggtgtaagttactttcttaatgcaaatgcaagtgcgaaattc 252  Q
    ||||||||| || |||||||||||||| ||| ||||||||  |||||||| ||||||||| | ||||| |||| |||||||||||| ||| || ||||||    
3344 atgtgcaagctgggattgattctcttagggagaaggcttccgaagttgatgtcttgaaggcgcaagttgctttattaatgcaaatgtaagcgcaaaattc 3443  T
253 tagagacaaagaggtaaattttacaaaactattgctaaaaca 294  Q
    |||||||| || ||||| |||||| |||||||| | ||||||    
3444 tagagacagagtggtaatttttaccaaactatttcaaaaaca 3485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 357 - 417
Target Start/End: Original strand, 1393582 - 1393642
Alignment:
357 tttgtatgttgtagctttgcgaaattaagtacatgatttggataatagagactcatagttt 417  Q
    |||||||||||| |||||| |||||| |||| |||||||||||||||||||||||||||||    
1393582 tttgtatgttgttgctttgtgaaattgagtatatgatttggataatagagactcatagttt 1393642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0232 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0232
Description:

Target: scaffold0232; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 21266 - 21308
Alignment:
170 gattctcttaaggataaggcttcacaagttgatatcttgaagg 212  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
21266 gattcacttaaggataaggcttcacaagttgatatcttgaagg 21308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0232; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 26349 - 26391
Alignment:
170 gattctcttaaggataaggcttcacaagttgatatcttgaagg 212  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
26349 gattcacttaaggataaggcttcacaagttgatatcttgaagg 26391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 170 - 212
Target Start/End: Original strand, 7190697 - 7190739
Alignment:
170 gattctcttaaggataaggcttcacaagttgatatcttgaagg 212  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
7190697 gattcacttaaggataaggcttcacaagttgatatcttgaagg 7190739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University