View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16635_low_23 (Length: 240)
Name: NF16635_low_23
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16635_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 421108 - 421322
Alignment:
| Q |
8 |
tgaaatgaaattaaaatcacgttgcaacaagaagaatgagattattagaagtaaaatatataaaagtcattctttatttttggaggtgtaaatagcaata |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421108 |
tgaaatgaaattaaaatcacgttgtaacaagaagaatgagattattagaagtaaaatatataaaagtcattctttatttttggaggtgtaaatagcaata |
421207 |
T |
|
| Q |
108 |
agatagccctaacctaatttgctgaaaagttatggttggggagagagagactttatctatccatccatctatctaactcatttcatttgattcagagaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421208 |
agatagccctaacctaatttgctgaaaagttatggttggg--gagagagactttatctatccatccatctatctaactcatttcatttgattcagagaaa |
421305 |
T |
|
| Q |
208 |
acagtgtgtaatgtaat |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
421306 |
acagtgtgtaatgtaat |
421322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University