View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16635_low_26 (Length: 230)
Name: NF16635_low_26
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16635_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 378855 - 378917
Alignment:
| Q |
119 |
tgtatatgtctgatagttctataccgcataatgtaatgta----taaattcgttgacaacttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
378855 |
tgtatatgtctgatagttctataccgcataatgtaatgtatctttaaattcattgacaacttt |
378917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University