View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16635_low_26 (Length: 230)

Name: NF16635_low_26
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16635_low_26
NF16635_low_26
[»] chr5 (1 HSPs)
chr5 (119-177)||(378855-378917)


Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 119 - 177
Target Start/End: Original strand, 378855 - 378917
Alignment:
119 tgtatatgtctgatagttctataccgcataatgtaatgta----taaattcgttgacaacttt 177  Q
    ||||||||||||||||||||||||||||||||||||||||    ||||||| |||||||||||    
378855 tgtatatgtctgatagttctataccgcataatgtaatgtatctttaaattcattgacaacttt 378917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University