View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16635_low_7 (Length: 402)
Name: NF16635_low_7
Description: NF16635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16635_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 21 - 241
Target Start/End: Complemental strand, 28053895 - 28053675
Alignment:
| Q |
21 |
atcgtgagcttctgcttccggattcggcgaaggtgtcttcgccggataaggatgttgttgatgttgatagaaggtttgaaagggaggcttcgttatctag |
120 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053895 |
atcgtgagcttctgcttccggattcagagaaggtgtcttcgcctgataaggatgttgttgatgttgatagaaggtttgaaagggaggcttcgttatctag |
28053796 |
T |
|
| Q |
121 |
attgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtgatgatattacaaaagaagatacgtcg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053795 |
attgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtgatgatattacaaaagaagatacgtcg |
28053696 |
T |
|
| Q |
221 |
tcgtttcgagtttctactaat |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28053695 |
tcgtttcgagtttctactaat |
28053675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 317 - 392
Target Start/End: Complemental strand, 28053599 - 28053524
Alignment:
| Q |
317 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053599 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
28053524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University