View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_high_10 (Length: 298)
Name: NF16636_high_10
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 47907329 - 47907533
Alignment:
| Q |
1 |
ataaggtcatattcaaaatgtattgtaaatagcattgtatttaaagttgnnnnnnnnnnnnnnnnnngtatactaaccatgaaatattatttgcaatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47907329 |
ataaggtcatattcaaaatgtattgtaaatagcattgtatttaaagtt-ttttttttttttttttttgtatactaaccatgaaatattatttgcaatgaa |
47907427 |
T |
|
| Q |
101 |
acgaattagttttccttggttaagnnnnnnngaagagaaaattaacccttatggcaccaaaaacatatatgtatttattgattaataagtacacatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907428 |
acgaattagttttccttggttaagaaaaaaagaagagaaaattaacccttatggcaccaaaaacatatatgtatttattgattaataagtacacatgttt |
47907527 |
T |
|
| Q |
201 |
tattca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
47907528 |
tattca |
47907533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 222 - 283
Target Start/End: Original strand, 47907565 - 47907626
Alignment:
| Q |
222 |
agtttatgatcaacaagaaggggattgactagaatggaagggttgaggtcttgaggtctgtg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907565 |
agtttatgatcaacaagaaggggattgactagaatggaagggttgaggtcttgaggtctgtg |
47907626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University