View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_high_13 (Length: 257)
Name: NF16636_high_13
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 36604032 - 36603788
Alignment:
| Q |
1 |
caaatattcgaatcagaattgtctgcggcccgcaatttgatgcatttatgcaattagcacatatgtgattgttcgatgaagatcaaatgatctaaacttc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
36604032 |
caaatattcaaatcagaattgtctgcggcccacaatttgacgcatttatgcaattagcacatatgtgatcgttagatgaagatcaaatgatctaaacttc |
36603933 |
T |
 |
| Q |
101 |
aagatcgatattttttattttaaaataaaatagtctacatcaaaatatatatcgtctgatctcgatccagtgatcacatatgtgctaactatgaaaataa |
200 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||| ||| ||| ||||| |
|
|
| T |
36603932 |
aagatcaatattttttatttcaaa-taaaatagtctacatcaaaatctatatcgtctgatctcgatccagtaatcacagatgtgctgactgtgagaataa |
36603834 |
T |
 |
| Q |
201 |
gtcaaatttctggccgcggatttctaaatattcatcttactttcat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36603833 |
gtcaaatttctggccgcggatttctaaatattcatcttacgttcat |
36603788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University