View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_high_7 (Length: 357)
Name: NF16636_high_7
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 36604388 - 36604044
Alignment:
| Q |
1 |
gcatgtggcattgctatcttcttcactctccccattggtataataaccgcaatcacaaaccaggtttgtatatacatagatcaaaagaagataaaaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36604388 |
gcatgtggcattgctatcttcttcaccctccccattggtataataaccgcaatcacaaaccaggttagtatatacatagatcaaaagaagataaaaatta |
36604289 |
T |
 |
| Q |
101 |
atttagtgacataaattagagataattaattttttcattggcttaatttctaattatagagtccagggctgaacataatcacggagtacatcataggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604288 |
atttagtgacataaattagagataattaattttttcgttggcttaatttctaattatagagtccagggctgaacataatcacggagtacatcataggata |
36604189 |
T |
 |
| Q |
201 |
tatctaccctggatatcctgtagctaacatgtgcttcaaggtttatggttacattagtatgacacaagccatcactttcttgcaagacttcaaactaggc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604188 |
tatctaccctggatatcctgtagctaacatgtgcttcaaggtttatggttacattagtatgacacaagccatcactttcttgcaagacttcaaactaggc |
36604089 |
T |
 |
| Q |
301 |
cactacatgaaaatccctcctagaaccatgttcatggcacaggtt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604088 |
cactacatgaaaatccctcctagaaccatgttcatggcacaggtt |
36604044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University