View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_low_15 (Length: 255)
Name: NF16636_low_15
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_low_15 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 14527 - 14305
Alignment:
| Q |
14 |
agaagtgtgagtatttaattacttatggtgatgatgagtcttatagttttggcgaattgagtactgattccattggttttggttcaatgaatggtgaagg |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527 |
agaagtgtgagtatttaattatttatggtgatga---gtcttatagttttggcgaattgagtaccgattccattggttttggttcaatgaatggtgaagg |
14431 |
T |
 |
| Q |
114 |
agaaaaagatgttacatttccaaaatcagtttttggatgtggacttcaaaatgatctaaggtctgaaactagtcataaaaccacaggtattgttggtcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14430 |
agaaaaagatgttacatttccaaaatcagtttttggatgtggacttcaaaatgatctagggtctgaaactagtcataaaaccacaggtattgttggtcta |
14331 |
T |
 |
| Q |
214 |
ggactagggccattgtccctagtttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14330 |
ggactagggccattgtccctagtttc |
14305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 112 - 168
Target Start/End: Complemental strand, 22470 - 22414
Alignment:
| Q |
112 |
ggagaaaaagatgttacatttccaaaatcagtttttggatgtggacttcaaaatgat |
168 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
22470 |
ggagaaaaagatgttacatttcctaaatcaatttttggatgtggacatcaaaatgat |
22414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University