View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_low_16 (Length: 238)
Name: NF16636_low_16
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 44 - 176
Target Start/End: Complemental strand, 25551535 - 25551403
Alignment:
| Q |
44 |
ttattctacggggtgggaacggatattatattacccgttttgaggacgtggatactaagagtgttcatcattaagaataaaagtgtctaatgcctcatat |
143 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25551535 |
ttattctacggggtgggaatggatattatactacccgttttgaggacgtggatactaagagtgttcatcattaagaataaaagtgtctaatgcctcatat |
25551436 |
T |
|
| Q |
144 |
atgataacattaaagtaggacacaaacactacc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25551435 |
atgataacattaaagtaggacacaaacactacc |
25551403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University