View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16636_low_6 (Length: 368)
Name: NF16636_low_6
Description: NF16636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16636_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 48 - 352
Target Start/End: Complemental strand, 7881170 - 7880866
Alignment:
| Q |
48 |
aattatcattggtttgtctaaagaattttgtcattagttttgtatacgtcgaattttaacggtagaaaataaatggctcattttgtgttttcttcttttg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7881170 |
aattatcattggtttgtctaaagaattttgttattagttttgtatacgtcgaattttaacggtagaaaataaatggctcaatttgtgttttcttcttttg |
7881071 |
T |
 |
| Q |
148 |
cttatttaatatatcttggaccccacaaaaattgtctcttcctgcatgattggaatacgtacaccaataattctgcacaacatgcagctaccgttcattt |
247 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7881070 |
cttttttaatatatcttggaccccacaaaaaatgtctcttcctgcatgattggaatacgtacaccaataattctgcacaacatgcagctaccgttcattt |
7880971 |
T |
 |
| Q |
248 |
tacaccgctaattgatcttcttgcatgaagacgacgacaaacctcaatagtacaatgactgaggaatggaagcaaaatctcaacgatcgagaaagacata |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7880970 |
tacaccgctaattgatcttcttgcatgaagacgacgacaaacctcaatagtacaatgactgaggaatggaagcaaaatctcaacgatcgagaaagacata |
7880871 |
T |
 |
| Q |
348 |
gacac |
352 |
Q |
| |
|
||||| |
|
|
| T |
7880870 |
gacac |
7880866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 7881239 - 7881191
Alignment:
| Q |
13 |
aaaatattagcctatacatattgtagaagtttaataattatcattggtt |
61 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7881239 |
aaaatattagcctatacatattatagaagtttaataattatcattggtt |
7881191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University