View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_high_57 (Length: 266)
Name: NF16638_high_57
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_high_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 44638825 - 44638572
Alignment:
| Q |
18 |
caaccgaatttttcatgtaaatgtagccactgttctatccattttcaagtaggcttcttgctgacttggtgggaaatgtgaaa-------------tcca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44638825 |
caaccgaatttttcatgtaaatgtagccactgttctatccattttcaagtaggcttcttgctgacttggtgggaaatgtgaaaagggaatgtgaaatcca |
44638726 |
T |
|
| Q |
105 |
cactccaatagacatacttgttgcaaattgcaatgcattttgccacatggtggctggtaggaggaactcgatgttgaagggtggttggttgcacataaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44638725 |
cactccaatagacatacttgttgcaaattgcaatgcattttgccacatggtggctggtaggaggaactcaatgttgaagggtggttggttgcacataaga |
44638626 |
T |
|
| Q |
205 |
accggaagataagcgtttcatcaagttaacatgacaaagaaactgcttcttctc |
258 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44638625 |
actggaagataagcgtttcatcaagttaacatgacaaagaaactgcttcttctc |
44638572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University