View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_37 (Length: 392)
Name: NF16638_low_37
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 162 - 379
Target Start/End: Complemental strand, 40182702 - 40182484
Alignment:
| Q |
162 |
aggtccctaacatgccattcgtgcctaccaaaacacttttt-atcaaagcaagtttttctagatataaatctgttccctattaaatttgacccatgacca |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182702 |
aggtccctaacatgccattcgtgcctaccaaaacacttttttatcaaagcaagtttttctagatataaatctgttccctattaaatttgacccatgacca |
40182603 |
T |
|
| Q |
261 |
gggtgaaaccttagagaccaaatttggctggtgtgtgttctgtcaactaaggatttgtgcccctccttttacaatgtctgacaataataatgtaatcatt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182602 |
gggtgaaaccttagagaccaaatttggctggtgtgtgttctgtcaaccaaggatttgtgcccctccttttacaatgtctgacaataataatgtaatcatt |
40182503 |
T |
|
| Q |
361 |
ggctagagttatatcccct |
379 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40182502 |
ggctagagttatatcccct |
40182484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 40182848 - 40182765
Alignment:
| Q |
17 |
agaagtttgtgaataaagtagcgcctctattcccctnnnnnnnn-gctgcggctctattgtgaaagggaaacctttaaggagag |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182848 |
agaagtttgtgaataaagtagtgcctctattcccctaaaaaaaaagtttcggctctattgtgaaagggaaacctttaaggagag |
40182765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University