View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_44 (Length: 362)
Name: NF16638_low_44
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 350
Target Start/End: Complemental strand, 12186133 - 12185804
Alignment:
| Q |
16 |
cttcttaccatatttctctatttannnnnnncaatccatgctaaattcactcttcagacatgaaagctccctagacttataacgacctaggactcaacct |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12186133 |
cttcttaccatatttctctatttatttttttcaatccatgctaaattcactcttcagacataaaagctccctagacttataacgacctaggaatcaacct |
12186034 |
T |
|
| Q |
116 |
ttaacactgcaaattataacttgcaataacatatcacatgtttgatttatttggggggaaaccnnnnnnntgaaatggaacagaaagttttttgttgatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12186033 |
ttaacactgcaaattataacttgcaataacatatcacatgtttgatttatttggggg--aaccaaaaaaatgaaatggaacagaaagttttttgttgatg |
12185936 |
T |
|
| Q |
216 |
acccaattattggttgcagaacaccattgtagtaatagtacaatattgggttcagcctgtttttcccaatatcggcgcaatgaacatgcagtcattatat |
315 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
12185935 |
acccaattattggttgcaaaacaccattgtattaatagtaca---ttgggttcagcctgtttttcgcaatattggcgcaatgaacatgcagtcattatat |
12185839 |
T |
|
| Q |
316 |
tgtggaaattgatgcgttgttggaaggtgttgctg |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12185838 |
tgtggaaattgatgcgttgttggaaggtgttgctg |
12185804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 209 - 257
Target Start/End: Complemental strand, 12191477 - 12191429
Alignment:
| Q |
209 |
gttgatgacccaattattggttgcagaacaccattgtagtaatagtaca |
257 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12191477 |
gttgatgatccagttattggttgcagaacaccattgtagtaataataca |
12191429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University