View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_51 (Length: 314)
Name: NF16638_low_51
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 11 - 141
Target Start/End: Complemental strand, 7424584 - 7424454
Alignment:
| Q |
11 |
attttcatttttggaatcagactatgttggcatagttgcttgaacgacaaaaatcactcatttgacaaacaccaacaacgannnnnnnngcagttaacaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
7424584 |
attttcatttttggaatcagactatgttggcatagttgcttgaacgacaaaaatcactcatttgacaaacaccaacaactattttttttgcagttaacaa |
7424485 |
T |
 |
| Q |
111 |
cttaacctaatgatttagtaaaatttaaatg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7424484 |
cttaacctaatgatttagtaaaatttaaatg |
7424454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 176 - 260
Target Start/End: Complemental strand, 7424024 - 7423940
Alignment:
| Q |
176 |
gatggatgaatgaatgttatggcaacggagaaggccatgatgtctcttcctctttctcaaaccttccctgttttcgttctccatg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424024 |
gatggatgaatgaatgttatggcaacggagaaggccatgatgtctcttcctctttctcaaaccttccctgttttcgttctccatg |
7423940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 142 - 177
Target Start/End: Complemental strand, 7424101 - 7424066
Alignment:
| Q |
142 |
attttgaaagtcacctttgaaacaaaccacaaagga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424101 |
attttgaaagtcacctttgaaacaaaccacaaagga |
7424066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University