View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_53 (Length: 311)
Name: NF16638_low_53
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 294
Target Start/End: Original strand, 47964007 - 47964294
Alignment:
| Q |
11 |
cacagagtaataggcaattctagaaagcaaataattaaatgtcgtcaaaagttagtgcccccatttgcctggcagtgttcttcttcctcttcttcacctt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47964007 |
cacaaagtaataggcaattctagaaagcaaataattaaatgtcgtcaaaagttagtgcccccatttgcctggcagtgttcttcttcctcttcttcacctt |
47964106 |
T |
 |
| Q |
111 |
cacatatgcaggaagacatggcccagtttcttcccctatcatttcaagcaataatcaatatgaggttagttcctttgattaatatcaaatcatattatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47964107 |
cacatatgcaggaagacatggcccagtttcttcccctattatttcaagcaataatcaatatgaggttagttgctttgattaatatcaaatcatattatat |
47964206 |
T |
 |
| Q |
211 |
gtaatctca----atgaagtagttcggcaaagtggttaaggagctttcatgaaatcaagttgttttgattgtattcaagtgcgatttt |
294 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47964207 |
gtaatctcaacgtacgaagtagttcagcaaagtggttaaggaactttcatgaaatcaagttgttttgattgtattcgagtgcgatttt |
47964294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University