View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_70 (Length: 238)
Name: NF16638_low_70
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 4939667 - 4939459
Alignment:
| Q |
15 |
aaaggtacatagattatttgggttggtcccatattatttattgaacatgagagttaaaataaaattcaacaacccgactgtacaattgtacaattgactg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4939667 |
aaaggtacatagattatttgggttggtcccatattatttattgaacatgagagttaaaataaaattcaacaacccgactgtacaattgtacaattggctg |
4939568 |
T |
 |
| Q |
115 |
acaaccaaatctaaactaactcacaactcgcacatgaagaaattaactatctttcnnnnnnntataattaatttggtgtttgaaattatagggttagatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4939567 |
acaaccaaatctaaactaactcacaactcgcacatgaagaaattaactatctttcaaaaaaatataattaatttggtgtttgaaattatagggttagatc |
4939468 |
T |
 |
| Q |
215 |
tttatagtg |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
4939467 |
tttatagtg |
4939459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University