View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_72 (Length: 235)
Name: NF16638_low_72
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 218
Target Start/End: Original strand, 49133430 - 49133638
Alignment:
| Q |
14 |
cagagacattcgtagcagctggtaagtttgaaaaaatacattttgattttgaaaaatcaaagtagctctctttgtttatatt----tatttatttatata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49133430 |
cagagacattcgtagcagctggtaagtttgaaaaaatacattttgattttgaaaaatcaaagtagctctctttgtttatatttatttatttatttatata |
49133529 |
T |
 |
| Q |
110 |
tcgtgctacaacatgacttgcaggactttcttcgggaaaaattggtaccatagcctatgcttgtatgcaggtagtttgctatccctatatgaatttctca |
209 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49133530 |
tcgcgctacaacatgacttgcaggactttcttcgggaaaaattggtaccatagcctatgcttgtatgcaggtagttttctatccctatatgaatttctca |
49133629 |
T |
 |
| Q |
210 |
tacatttat |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
49133630 |
tacatttat |
49133638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University