View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_75 (Length: 220)
Name: NF16638_low_75
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 7813438 - 7813234
Alignment:
| Q |
1 |
tgctaagagaatcactgttatgcccgaggatatacaattggccagaagtatccgtggtgaatgtgatcaagaaggatggctacttataagaaattgaact |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7813438 |
tgctaagagaatcactgttatacccgaggatatacaattggcaagaacgatccgtggtgaatgtgatcaagaaggatggctacttataagaagttgaact |
7813339 |
T |
 |
| Q |
101 |
tcgtctcttggtgtcaaggtcaaagtattaccacaatgttcaaatatcatcaactcctttaagaatcttttttattgcataatatatactttaattgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7813338 |
tcgtctcttggtgtcaaggtcaaagtattaccacaaagttcaaatatcatgaactccattaagaatcttttttattgcataatacatactttaattgatg |
7813239 |
T |
 |
| Q |
201 |
gcata |
205 |
Q |
| |
|
||||| |
|
|
| T |
7813238 |
gcata |
7813234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 7803748 - 7803682
Alignment:
| Q |
1 |
tgctaagagaatcactgttatgcccgaggatatacaattggccagaagtatccgtggtgaatgtgat |
67 |
Q |
| |
|
||||||| || ||||| |||| || |||||||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
7803748 |
tgctaagcgagtcactattatacctgaggatatacgattggcgagaaggatccgtggtgaatgtgat |
7803682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University