View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16638_low_81 (Length: 203)
Name: NF16638_low_81
Description: NF16638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16638_low_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 55075423 - 55075251
Alignment:
| Q |
15 |
gaagaatattttagaaaccacacaaaattactaatatcaattaaaattccaaacaacagaagactaatctagctggatagagtagaggttagcatcttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55075423 |
gaagaatattttagaaaccacacaaaattactaatatcaattaaaatttcaaacaacagaagactaatctagctggatagagtagaggttagcatcttca |
55075324 |
T |
 |
| Q |
115 |
tgtgaagagaggatatcatgatatcacagggccctttatcttacaatgtgttgtcttgatgagaggatttgtg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55075323 |
tgtgaagagaggatatcatgatatcacagggccctttatcttacaatgtgttgtcttgatgagatgatttgtg |
55075251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University