View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16640_high_17 (Length: 228)
Name: NF16640_high_17
Description: NF16640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16640_high_17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 40656825 - 40657036
Alignment:
| Q |
17 |
aggaagagcattattcatatgttgtggagatgttatgtagagctggtaacctcaaagaagccgttgacatcgtggaaaagatgccgtataaaactaccac |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40656825 |
aggaagaacattattcatatgttgtggagatgttatgtagagctggtaacctcaaagaagccgttgacattgtggaaaagatgccgtataaaactaccac |
40656924 |
T |
 |
| Q |
117 |
ggacatttggaggtcaattctttctgcttgtgcagtgtctggagacttgcaagatattgaagtagttgcgacgaaaataatggagagggcaccacagata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
40656925 |
ggacatttggaggtcaattctttctgcttgtgcagtgtctggagacttgcaagatattgaagtagttgcgacaaaaataatggagagggcaccacaaata |
40657024 |
T |
 |
| Q |
217 |
tccttaccttac |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40657025 |
tccttaccttac |
40657036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University