View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16640_low_17 (Length: 240)
Name: NF16640_low_17
Description: NF16640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16640_low_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 82 - 240
Target Start/End: Complemental strand, 45520111 - 45519953
Alignment:
| Q |
82 |
ctaagaaaaatgaagaagaagatcatatatagctagcaaaggacggaagccaagtaatgttcatttgaaaactaatgatggagggggtgcagtttaaatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45520111 |
ctaagaaaaatgaagaagaagatcatatatagctagcaaaggacggaagccaagtaatgttcatttgaaaacgaatgatggagggggtgcagtttaaatc |
45520012 |
T |
|
| Q |
182 |
taatactatatagaagatcgatgataacgacaccaaatgtcatcaatactacttgttaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45520011 |
taatactatatagaagatcgatgataacgacaccaaatgtcatcaatactacttgttaa |
45519953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University