View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16641_high_13 (Length: 211)

Name: NF16641_high_13
Description: NF16641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16641_high_13
NF16641_high_13
[»] chr5 (1 HSPs)
chr5 (8-195)||(812361-812546)


Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 812361 - 812546
Alignment:
8 agtgagatgaatataaaatgaaatgaaatattagtttatatcacaaactaagagaatccgcaatgaatttggagttggtgcattaacttgtgtggcacat 107  Q
    ||||| |||||||||||||||||||||||| |  ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
812361 agtgaaatgaatataaaatgaaatgaaatagt--tttatttcacaaactaagagaatccacaatgaatttggagttggtgcattaacttgtgtggcacat 812458  T
108 ttactactctcaactgtccgatttggtttaacggctgagatcatacagcttcactaaaactgatgtgtaatcttaacagtctaatctc 195  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
812459 ttacttctctcaactgtccgatttggtttaacggctgagatcatacagcttcactaaaattgatgtgtaatcttaacagtctaatctc 812546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University