View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16641_high_9 (Length: 256)
Name: NF16641_high_9
Description: NF16641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16641_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 238
Target Start/End: Original strand, 10416247 - 10416478
Alignment:
| Q |
7 |
gtgagatgaatatctgagtagtaagactcaaaatgggattcaaattcaaaattaattgagctcgcatcctcttcagcgtctccatcctttgcagccgacg |
106 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10416247 |
gtgacatgaatatatgagtagtaagactcgaaatgggattcaaattcagaattaattgagctcgcatcctcttcagcgtctccatcctttgcagccggcc |
10416346 |
T |
 |
| Q |
107 |
accaacttttgaccgtagagattggagacgccgagaaaatgtggttgcaattatgatgattgtattgcaagtatcgacattcaaaatttgaatatagata |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416347 |
cccaacttttgaccatagagattggagacgccgagaagatgtggttgcaattatgatgattgtattgcaagtatcgacattcaaaatttgaatatagata |
10416446 |
T |
 |
| Q |
207 |
gataaaaactggttaagttaaagagtaatgca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10416447 |
gataaaaactggttaagttaaagagtaatgca |
10416478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University